Bio 201 Final Review

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? – The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. – TRUE ________can convert proto-oncogenes into oncogenes. – Nonsense mutations Most human embryos that are aneuploidy – are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. – FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? – 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. – BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? – mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called – maternal effects.If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits â €“ are on the same chromosome. An episome is – a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. – FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. – an F factor What can be inferred from an organism that has undergone a gene knockout? – The GMO is a homozygote and the cloned gene carries a mutation.Which of the following is an example of a clone on the organism level? – identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? – G1 Certain types of cancer are caused by viruses. – TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as – both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to – get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? – random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain – All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. – FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. – TRUE Which of the following does not contribute to the infectious ability of prions? – Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? – Plant cells are totipotent. Which of the following is an advantage of molecular pharming? – The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACCNormal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp – base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. – FALSE A gene created from the fusion of two gene fragments is considered a – chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. – FALSE In a tetraploid species, a euploid individual would have ___sets of chro mosomes. – 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? – F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that – two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. – FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is – codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance – can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. â €“ competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex.Bacteria can exchange DNA between strains of the same species and between different species. – TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? – xeroderma pigmentosum Cancers originate from a single cell. – TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? – two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? – centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.What is the probability that their next child will have blue eyes and be nearsighted? – 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? – Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. – TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because – All of the statements given are true. Quantitative traits – are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and lengt h are linked, what would be a possible ratio for the F2 population? | – 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. – TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is – a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. – TRUE Which of the following is a possible use for gene cloning? – All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? – Every band matches. What is required for a group of clones to be considered a contig? – The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose met abolism. What type of mutation could be responsible for this shorter than normal protein? – nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be – metastatic. The process by which haploid cells are produced from diploid cells is called – meiosis In a haploid dominant species – the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that – alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? – both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? – either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called – epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. – 3,2Drugs that are HIV protease inhibitors – prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. – TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. à ¢â‚¬â€œ TRUE The entire collection of a species' proteins is known as its – proteome Which of the following pollutants could be reduced with the use of bioremediation? – All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. – TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? – a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. – FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) – oncogene The formation of the bivalent during meiosis – contributes to the genetic diversity of a species.A male is hete rozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. – 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. – TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. – FALSE Which of the following statements correctly describes a quantitative trait? – People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. – a sex pilus, single strand of DNA Integrase – cuts the viral genome and is required for both prophage and provirus formation.Which of the fol lowing is an advantage of cDNA libraries? – cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage – TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. – FALSE In mammals, males are ________ and females are ____________. – hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. – 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. – cytoplasm Place the following events of bacterial transformation in order from first to last. – DNA replication b â €“ an enzyme joins F factor DNA ends c – sex pilus shortens d – DNA transfer e – an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? – plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? – They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? – tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. – two haploid, 4 haploid Which of the following mutations will not alter the amou nt of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. – TRUE The sex of all animals is determined by chromosomes. – FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? – missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? – Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosse s performed by Mendel support the observation that – the two alleles for a given gene are distributed randomly among an individual's gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission – All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. – supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? – A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense S hould a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. – checkpoint proteins In mitosis, the main difference between plant and animal cells is that – plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? – the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? – Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.Which of the f ollowing DNA repair systems is responsible for the correction? – direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce – a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? – 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in – an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant â€Å"rescue† could have been caused by â₠¬â€œ addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? – Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? – cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone – gene amplification. All of the following are chemical mutations EXCEPT – X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? – Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is – pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? – Triple X syndrome Prokaryotes – include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a threat to human health due to – All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. – S Sexual life cycles include both haploid and diploid stages. – TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O ? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the ot her parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce â€Å"Labradoodles† is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and met aphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breedi ng a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow â€Å"Texas Beauty† rose with a true-breeding â€Å"Ruby† red rose, you get all red roses. But when you cross a â€Å"Texas Beauty† yellow with the yellow variety â€Å"Jealousy,† you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scienti st has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? – The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? – All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins – do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because – if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. – IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because – HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in – the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? – polymerase chain reaction (PCR) Polyploidy in plants – All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, – chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because – they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? – 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? – A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.

Othello vs Iago

It is a known fact that the actions someone makes throughout his/her life fashions the kind of person he/she is, however this is not always the case. Ultimately it was Othello who was in control of his own behaviour though he was highly influenced. Despite the fact that Iago had finished the deed of killing Roderigo, he was more in control of the others thoughts than actions. Together, Iago and Othello were fundamentally in charge of their lives though powerless to their thoughts and actions.Nonetheless only one can be the most responsible for the tragic events that occur in this play. Insecurities have a powerful effect on the human mind, and thats just what happened to Othello, he succumbed to his insecurities. Being a different race and a general could be said to be rare in the time period that this play took place which may have led to why Othello was reacting so irrationally. He allowed his mind to play tricks on him by latching on to anyone who had shown kindness to him during a stressful event which led to his fatal flaw: Pride.Though he loved Desdemona with all his heart, his pride seemed to be a bit more important. He would not listen to his wife because of the newfound tainted picture of her which meant to him to eliminate the one thing that would ruin his image of himself. In the end actions spoke louder than words and he gave in to the murderous ways that ago had planted in his head. With a great minds comes great responsibilities, responsibilities Iago seemed to ignore by allowing his jealousy to take over.Honest Iago truly was honest however, he was also extremely clever. He knew how to twist the thoughts of the people around him turning them into his little puppets in order to keep his hands clean. A highly effective instigator which led to the deaths of all the characters who died by manipulating the people around him. when all is said and done, it was Iago who really Influenced the actions preformed by Othello.

English difficulties Essay Example | Topics and Well Written Essays - 750 words

English difficulties - Essay Example This paper will define this difficulty primarily among the immigrants because the French-speaking population enjoys the privilege of being one Canada’s two national languages. French is explicitly protected as well as promoted in Canada particularly through the Official Languages Act of 1968. Throughout the country, English and French appear together on cereal boxes, in public places such as airports, parks and restrooms. In addition, all federal government publications are issued in both languages. (Ricento and Burnaby 1998, p. 305) And so the French speakers do not suffer the dilemma faced by immigrants who come from other countries with different languages. According to the World Bank, between 1980 and 2002, Canada became home to 4.2 million immigrants as an average of 181,000 people entered the country annually. (Maimbo and Ratha 2005, p. 144) The demographics of these immigrants illustrates a dominant non-English speaking population: 58 percent came from Asia and the Middle East; 20 percent from Latin America and the Carribean; 8 percent from Africa. (p. 144) Learning a new language is one of the greatest problems for foreign-trained migrants as this is essential in adapting to the community and the workplace. Goodman and Graddol (1996) stressed that all professional associations and in trade, to some degree, consider fluency essential to safe practice and public safety. (p. 224) Their point is that English language proficiency is considered to be an objective measurement of one’s ability to perform in work and everyday life. And so, non-English speakers are faced with the challenges of English assessment for registration in professional associations, job application and in school admissions. Non-English speakers have difficulty accessing community program of any description. The government does provide translation services for a more comprehensive access to its services, the budget for it is limited. For example, Toronto offers third-party

A DOLL'S HOUSE BY Henrik Ibsen Essay Example | Topics and Well Written Essays - 750 words

A DOLL'S HOUSE BY Henrik Ibsen - Essay Example You were a successful professional and a decent family man. You were a Man, who observed all the social rules and satisfied all the social expectations. But that was all. That evening I realized that you had no inner life, no identity other than your social one. Social rules and others’ opinion meant for you more than people around you. You thought of yourself through the eyes of others and you treated people according to their social roles. Those, who dared to break the rules you minded, who were inappropriate to the position you occupied, were to be isolated as immoral and dangerous. Your conventionality spread over your entire life, and even your attitudes to me. It was so pleasant (and so respectable) to have a young and beautiful wife, who was a triumph at all the parties, contributing to your firm position, and who entirely belonged to you! It aroused your desire, a desire of a lucky hunter. No, you did not love me. I was your trophy, your male toy. I existed merely to p erform tricks for you, Torvald. Do you remember what I told you that evening? Our marriage was a long-lasting performance; our home was a doll’s house. I was your doll-wife, and our children were my dolls. I thought it great fun when you played with me, just as they thought it great fun when I played with them. As you put it: The unutterable ugliness of it all! For shame! For shame! To feel a man you needed to hold me tight. My ‘womanly helplessness’, as you called it, gave me a double attractiveness in your eyes. I played the game you offered me. I had been taught this game since my childhood. And I liked it. It provided me with a well-known comfort. I knew, how painful and humiliating it would be for you, with your ‘manly independence’, to know that you owed me anything, that I was not that weak and brittle you wanted me to see! I realized that such knowledge would upset our mutual relations altogether and put the

Alcoholism and Its Effects to the Community of Jersey City Term Paper

Alcoholism and Its Effects to the Community of Jersey City - Term Paper Example There is also the study of the various societal issues that affect the city. One of the issues is alcoholism and its effect on the population of the city spreads wide. It is important to review these issues and the various health issues that accompany it in both a human and the society as a whole. The demographic study of the area shows that in the 2010 census, the country had around 246,594 people in total. Of this vast population, people under the age of 18 years were 23.5%. The number of people from the population that was above the age of 65 was 13.5%. Scrutinizing the gender aspect of the population, there was some form of balance as 51.3% of the people were females. The city has a vast population of white people as compared to black people despite its proximity to the suburbs of New York that have very many black people. In New Jersey, 69.1% of the population comprised of white people while 13.7% represented the black community. The rest of the population remaining to make up 1 00% comprised people of mixed Races and backgrounds (Jacobs, 2012). Other statistics on the city tend to show the various issues involved with the drinking population of the city. Alcoholism has been an issue on the rise and the police have grown more vigilant in an effort to curb this issue. The national bureau of statistics brought out the Driving under the Influence statistics. Drunk driving in the United City is a very widespread felony and the reduction of this is very influential. The statistics showed that earlier years and specifically in the year 1995, 689 cases of drunken driving reports in New Jersey came in. By the year 1999, the cases had gone down as 653 cases of drunk driving were reported. However, of the most recent statistics from the 2009, there were 721 cases of driving under the influence. That was a very sharp increase as compared to initial years (Jacobs, 2012). The Alcoholic Anonymous is one of the services that have had its services in New Jersey of the few past years. This is because of the noted increase in alcoholism in the city. 77% of the alcoholics in Jersey City do not actually recognize the service and just go on with their daily activities. However, for the 23% of the population that pays attention to the recent trends in the system, they have benefited greatly through training and there have been some extra services of the past three years to help reduce the addiction of some of the members. The number of people migrating out of the city in the past 3 years has increased steadily. Interviews with some of these people clearly show that the 15% of the reason behind this is alcoholism. The people state that it is hard for them to bring up their children in the neighborhoods as they feel that they will grow to be regular drinkers as has been the case of many of the people living there without the ability to control oneself (Cindy, 2008). There was also the review of the number of pubs in the city and this goes well to support the issues brought out by the emigrants. Studies show that over the last three years, the number of pubs in Jersey City has increased at a rate of around 27%. The reason as to why this has happened is the fact that the tax rate on alcoholic beverages has gone down from the last budget. This has made entrepreneurs major in venturing into the alcoholic business that seems profitable by a very large margin. Jersey City is known to be one that is easily influenced by changes around and the amount of peer

Who were the Hippies and how did they influence the culture of the Essay

Who were the Hippies and how did they influence the culture of the 1960s - Essay Example They influenced the counterculture of 1960s in that they tried to push the social and political order toward non-conventional ways. They challenged the traditional ways of living by taking over a practice of cultural dissent from the bohemians and the beatniks. Hence, their lifestyle was just opposite to the lifestyle of the contemporary Americans. 2. The gay movement is the current counterculture movement (Gallaghar & Bull, 1996). The earliest known gay rights organization is the Society for Human Rights in Chicago that was established in 1924. After that, the Mattachine Society was established in 1951, and there have been a number of other organizations and movements till then which support gay rights. The Defense of Marriage Act (DOMA) passed by Congress in 1996 protects the marriage rights of gays since there were many states which had banned gay marriages before 1996. Congress approved the law in 2010 and legalized gay marriages. Gay rights include ceremonial marriages, child adoption, domestic partnership registration on public record, domestic partnership affidavit given by employers to gay employees that defines the couple’s economic relationship, health care, insurance, lawsuits, property, and the like. Hence, gay movements form the current counterculture because they present a different lifestyle that is not

Discussion Board 8-1 Essay Example | Topics and Well Written Essays - 250 words - 2

Discussion Board 8-1 - Essay Example This presents a real risk especially in cases where the counselor has not found a safety shelter for the victim of abuse. Alternative shelter during handling of a case helps isolate a victim from the abusers and encourage in-depth if not complete disclosure (Jackson-Cherry, 2014). Another reason for delay relates to the dilemma that strikes counselors especially when reporting of a case is likely to lead to separation of parents of an abused. A counselor may wish to advance and find justice treatment while ensuring compactness of the family, but fears breakup of the family upon reporting. To deal with such causes of procrastination, counselors need to stick by the laws and ethics of their respective states regarding reporting of child abuse cases. Another way to avoid procrastinations of reporting child abuse due certain fears is to refer clients to other superior authorities or institutions also concerned with protection of children welfare. Alternatively, a counselor can contact a mandated reporter to report the case on behalf. Section 350 of the Hawaii State’s laws against child abuse require quick reporting of child abuse, and outlines provisions for prosecution of a counselor for late reporting of a child abuse incidence (Hawaii.gov,

Finance for managers essay Example | Topics and Well Written Essays - 1250 words

Finance for managers - Essay Example There are generally no hassles when owned capital is employed for executing budgetary plans. But problems arise on use of debt capital. These problems of debt financing are as under: 3. Financial leverage or gearing of the capital employed affect future funding for the business. For example during periods of depressions the entities will find difficulties in raising capital through issuance of equities. On basis of study conducted by Catherine Stenzel and Joe Stenzel (page 82)2, it may be observed that irrespective of model of the budget adopted, budgets normally incorporate three mistakes that limit the scope and decision taking abilities of the entities. Those three mistakes are as under: It is seen that budgets do not align resources to strategic objectives of the firm. Budgets do not reveal the business strategies. Logically the budgets should translate the strategic goals into actionable operations in quantitative terms. But this does not happen. Budgets and strategic objective some time appear far apart in planning the use of resources. Budgets are constructed keeping in mind the resources in hand. There is no planning under budgetary process to create resources to meet strategic objectives. Entities declare mission statements and strategic objectives enthusiastically in big way. It is seen that during budgeting, very few so called flaccid budgets, that are presently in operations, care for business plans and plan activities to achieve those strategic goals. In words of Catherine Stenzel and Joe Stenzel ‘one final flaw that can reduce budgeting relevance and lead to flaccid budget centers on parochial claims to resources.’ That is to say resources under budgetary process are allocated on competitive basis and not as per preferences set out in the strategic objectivity. Conventional budgets do not describe methods for arriving at budget proposals or at allocation of funds. The methodology

Constipation Essay Example | Topics and Well Written Essays - 500 words

Constipation - Essay Example According to Mitchelle, constipation is an embarrassing topic to talk about though is a common problem that affects people. Constipation makes one feel uncomfortable, sluggish, bloated and heavy. Removal of waste from the body regularly makes one healthy and is vital to living. Constipation diagnosis is based upon the symptom displayed, medical history and physical examination. Mostly, constipation is diagnosed by a doctor or self-diagnosis. However there are situation where the doctor feels that there is a need to carry out some test and special diagnosis for more complicated cases of constipation that is chronic (2). In India, most patients who have constipation are the middle-aged men and have a sense of incomplete bowel movement. Abdominal discomfort is not universal but can be frequent. When a research was carried in India stool frequency was similar irrespective of whether the patient constipated or had a diarrhea. Ninety percent had one or two stools per day and these symptoms were complex and suggested presence of IBS. Study from India have used western criteria have defined constipation, indeterminate was found to be the most common symptoms’ among patients who presented themselves with chronic functional lower GI symptoms, but majority of them had predominant constipation. Studies have shown that women are more prone to constipation as compared to men in most parts of the world but in India, more men are reported to be having constipation than female. These tests were hospital based (Goshal, 1). The nurses should create a healthy care plan so that they can keep the patient with good health. They should mobilize the patient and encourage them to have regular exercise or attend exercise classes. This will help stimulate the patient to have a bowel movement. The information that they got during the NP practice, should be used to educate the patient and help them review the kind of diet component a

Death Comparison Essay Essay Example for Free

Death Comparison Essay Essay Editors play influential roles in literature. They can easily alter the overall atmosphere of literature or change the message behind it. Different versions of the poem â€Å"I heard a Fly buzz†¦Ã¢â‚¬  by Emily Dickinson demonstrate different caesura, capitalization and word usage. The 1955 edition by Thomas H. Johnson and the original version by Emily Dickinson portray almost identical ideas and emphasis through limited alteration of caesura and word capitalization in relation to death as somewhat unimportant event. Caesura is one of the most crucial elements in classic English poetry. It can either change the pace or the atmosphere of the work. Emily Dickinson uses caesura in her poem â€Å"Dying† to demonstrate death as a slow and unspiritual event. Both the 1955 edition and the original edition share the same style of caesura from the start to the end. In the original version, Dickinson uses a vast number of hyphens between sentences. For example, the first two sentences of the poem, â€Å"I heard a Fly buzz-when/ I died-†, depicts how the author uses hyphens between every phrase to portray short breaths of a dying individual. The author uses short breathed pace of the poem to describe the narrator’s slow process of death and nonspiritual side of death. In addition, the author implies how death does not contain any kind of sudden or spiritual endings. In the 1955 edition, Johnson places caesuras in almost identical places to preserve the original work’s perception of death. As a result, the 1955 edition successfully displays images of a dying narrator and the short paced poet structure. With the same style of caesura, the 1955 edition brings out the original version’s idea about death being a slow yet nonspiritual everyday occurrence. Often poets use capitalization as a tool to emphasize specific words. Two versions of the poem â€Å"Dying† capitalize overlapping words to express equal emphasis. In the original version of the poem Emily Dickinson constantly  focuses on incoherent words such as â€Å"room† and â€Å"fly.† The author uses emphasis on the room to create an illusion of an isolated space. Dickinson utilize this illusion introduce the emptiness of death. The constant capitalization of the word â€Å"fly† causes readers’ attention to move away from the dying narrator. This ironic emphasis on the fly, transforms this serious theme called death into something that is minor and insignificant. Two versions of the poem, the 1955 edition and the original edition, have minor difference in their capitalization style; the only difference is the capitalization of the word around. In the 1955 edition, Johnson capitalizes the words â€Å"fly† and â€Å"room† throughout the poem. As a result of this capitalization Johnson successfully creates an atmosphere that is identical to the original version. Johnson also inherits Dickinson’s original intention to minimize the importance of death and to make something miniscule, a fly, as the center of attention. The 1955 edition shares an incredible amount of similarities with the original version; the style of caesura and the capitalization of specific words. The 1955 edition places hyphens in the exact same places to preserve the original version’s ideas about death being a slow natural process. In addition, both of the 1955 edition and the original version emphasize significant words such as â€Å"fly and â€Å"room† to represent the insignificance of death, rather than portraying death as a major event in human lives. Bibliography I Heard a Fly Buzz When I Died (591). By Emily Dickinson : The Poetry Foundation. N.p., n.d. Web. 11 Oct. 2012. http://www.poetryfoundation.org/poem/174972.

Heterocycles: Types and Biosynthesis

Heterocycles: Types and Biosynthesis Heterocycles1 are one of the major classes of organic compounds. They are cyclic compounds containing one or more heteroatom (oxygen, nitrogen, sulphur etc.). These compounds are of biological and industrial importance. Many materials that are essential to life include a heterocyclic moiety; examples of these are: amino acids, nucleic acids, pigments, vitamins, antibiotics and many more. Heterocycles are part of our everyday life and are present in: drugs, dyes, pesticides and plastics.2, 3 Most common heterocycles are five or six membered ring; examples of these are pyridine, pyrrole, furan and thiophene (Figure 1). It is also possible to find two or more of them fused together to give even more complex structures.4 Figure 1: Common heterocyclic structures Many heterocyclic compounds are biosynthesised by plants and animals and hence have biological activity. These include as the haem group in the blood, and the chlorophylls ,essential for photosynthesis, both of these are essential to life.5 Examples of heterocycles used in the pharmaceutical industry include the pyridine based anti-AIDS-virus drug Nevirapine6, or the vasodilator Nicorandil for the treatment of angina (Figure 2).7 Figure 2: Example of heterocyclic drugs Pyrimidines are an important class of heterocycles that are essential to life and biologically and pharmacologically active. Cytosine, thiamine, uracil, adenine, guanine are the nitrogen bases that are present in both DNA and RNA (Figure 3); derivatives of these have been used to form the core of drug molecules, due to their ability to selectively interact with the human body.3, 7 Figure 3: Pyrimidines 2. Synthesis of heterocycles There are various traditional pathways leading to high yielding heterocyclic synthesis. Two of the most common are: Fischer-indole1, 8 synthesis and a Hantzsch synthesis to obtain the pyridines. Fisher-indole synthesis (Scheme 1) has been the most important method for the preparation of substituted indoles. It involves the formation of an imine 1.3 from a hydrazine 1.1 and a ketone 1.2. This will then tautomerise to give a enamine 1.4 that will subsequently undergo a [3,3] Cope rearrangement and form a di-imine 1.5, that will then aromatise. The aromatised amine 1.6 will undergo further intramolecular cyclisation to give the indoline 1.7 which will also aromatise to give the second ring system of the indole 1.8.4, 7 Scheme 1: Fischer-indole synthesis of indoles The Hantzsch1, 8 synthesis (Scheme 2), is a three component reaction, which firstly involves an aldol condensation of a diketone 2.1 with acetone 2.2. This is then followed by a conjugate addition of another equivalent of a diketone 2.1 to give a tetraketone 2.4. By adding ammonia it will lead to the formation of an imine and enamine component 2.5, which will subsequently react with sodium nitrate and acetic acid to aromatise to give pyridine 2.6.9 Scheme 2: Hantzsch synthesis of pyridines These two synthetical techniques have been greatly utilised however they have their downsides; which range from the need for high temperatures, large amounts of stoichiometric reagents, as well as the poor accessibility of the starting materials. This has therefore driven research for the discovery of new methodologies for an efficient route for the synthesis of heterocycles and their derivatives. A wide range of new heterocyclic synthetic routes using metal cross coupling reactions have arisen in particular utilising palladium as catalyst10, examples which are considered in the section below. 2.1. Synthesis of indole heterocycles using catalysis A palladium catalysed Fisher indole synthesis has been discovered by Wagaw et. al.. It involves the cross coupling of an aryl bromide and a hydrazone. This palladium catalysed reaction has proven to be very versatile in respect to the functionality of both the reagents used. The addition of the p-toluenesulfonic acid monohydrate hydrolyses imine 3.3 therefore liberating the hydrazine which will subsequently react with a ketone to give a hydrazone. This will then undergo standard Fischer-indole process to produce 3.4 (Scheme 3).11 Scheme 3: Palladium catalysed Fischer-indole synthesis 2.1.1. Palladium catalysed reactions Palladium catalysed reactions have been regularly used in both academic and industrial synthetic chemistry laboratories as an important method for the formation of carbon-carbon and carbon-heteroatom bonds. These have been heavily applied in the synthesis of pharmaceutically and biologically important molecules.1, 12 Many palladium catalysed reactions go through a similar catalytic cycle. The catalytic species can be formed in situ by using a palladium source such as Pd(PPh3)2Cl2 or Pd(OAc)2 with the addition of an appropriate ligand. By choosing the correct ligand this can improve two steps in the catalytic cycle; oxidative addition and reductive elimination.13 A common feature of these catalytic process (Scheme 4) is the formation of aryl/alkyl Pd(II) intermediates which will then be functionalised to form C-C or C-Heteroatom bonds that are cleaved off from the metal centre.14 Most of the Pd catalysed reactions undergo the same basic catalytic cycle involving; oxidative addition, transmetallation and reductive elimination. Scheme 4: Palladium catalytic cycle 2.1.2. Palladium catalysed cross coupling reactions Below in Table 1 are described some of the most common palladium catalysed reactions.15-18 Table 1: Palladium catalysed reactions Name of Reaction Suzuki Stille Negishi Hiyama Sonogashira Heck Buckwald-Hartwig Catalyst Pd(0) Pd(0) Pd(0) Pd(0) Pd(0), Cu(I) Pd(0) Pd(0) Base Yes No No Yes Yes Yes Yes Reagent 1 Reagent 2 R= EWG (eg. NO2, CN, COOR) Product 3. Recent examples of heterocyclic synthesis There are various recent examples of interesting heterocycles synthesis. Large amounts of research covering aspects of C-H activation, atom economy improvements and efficiency with the use of different solvents has been carried out to improve the conditions of the synthesis. An interesting class of heterocyclic moiety is pyrimidines due to their desirable biological activity. Over recent years the pyrimidine system (Figure 4) has been shown to be an important pharmacophore.19 Figure 4: Pyrimidine moiety Pyrimidines are very prevalent in nature; they are the precursors for the nucleoside bases of both DNA and RNA (Figure 3) and are also found in many more natural products such as vitamins and antibiotics. Examples, of this class of heterocycles, are shown below in Figure 5.19 Figure 5: Natural products containing pyrimidine moiety As a result of this long-lasting interest in the pyrimidine moiety as well as in its derivatives in the use as potential drug targets, the synthesis of this heterocyclic ring has been expansively researched.15 Good yielding strategies have been developed primarily on the basis of nitrogen-carbon-nitrogen condensation reactions. An example of this is the Pinner addition (Scheme 5) of guanidines 5.2 and amidine salts to 1,3-diketones 5.1 or their derivatives.20 Scheme 5: Pinner addition for the synthesis of pyrimidines 3.1. Synthesis of ÃŽ ²-Enaminones: an entry into pyrimidines Gayon et. al.21 have demonstrated highly stereoselective synthesis of ÃŽ ²-enaminones via based catalysed rearrangement of propargylic hydroxylamines. ÃŽ ²-Enaminones are versatile compounds that have been used for their pharmacological activity, as building blocks for natural product synthesis and heterocyclic synthesis. The initial discovery showed that propargylic hydroxylamine 6.1 underwent rearrangement to give the Cbz-protected enaminone 6.2 as a single (Z) diastereomer (Scheme 6) which could then be used for the synthesis of heterocyclic compounds such as pyrimidines. Scheme 6: Base catalysed rearrangement reaction to afford ÃŽ ²-enaminones The reaction mechanism (Scheme 7) starts from the deprotonated aminol 7.2 that is easily formed; this is due to the association of the hydroxyl anions present in solution with the propargylic hydroxylamine 7.1. With the deprotonation takes place at the propargylic position an imine 7.3 is formed this is also because of the elimination of hydroxyl anions which are triggered by the deprotonation itself. Hydroxyl anions add to the imine which will eventually for the allenol 7.4. This can then undergo keto-enol tautomerisation to produce the deprotonated enaminone 7.5. The last step involves proton exchange between another molecule of propargylic hydroxylamine 7.1 and the anionic deprotonated enaminone 7.5 to give the product and another molecule of aminol 7.6. Scheme 7: Mechanism for rearrangement These enaminones proved to be an interesting building block for the synthesis of heterocyclic compounds such as pyrimidines. The presence of a nucleophilic nitrogen atom, a double bond and an electrophilic carbonyl provided an different cyclocondensation process to simple Pinner addition on the basis of the addition of an electrophile/nucleophile partner; such as a carboxamide. Scheme 8: Propargylic hydroxylamine to pyrimidines The presence of the nitrogen atom on the enaminone 6.2 is advantageous for an alternative synthetic route for the synthesis of functionalised pyrimidines (Scheme 8) from readily commercially available and inexpensive carboxamides that can give easier access to pyrimidines. 3.2. Synthesis of Pyrazine Heterocycles and their Derivatives Pyridazines have been considered one of the ‘most drugable’ heteroaromatic rings for medicinal purposes.22 Its analogues have proved to be good starting points for developing drugs for various molecular targets and have demonstrated biological activity in many key areas such as obesity, neurodegenerative diseases, inflammatory pain and many more.22 Abed et al. have recently elaborated a synthesis of novel fused pyridazines by carrying out a diaza-Wittig reaction on 1,3-diketones (Scheme 9).20 Scheme 9: Synthesis of pyrazine heterocycles The work was divided in two parts; the first was the development of a convenient strategy to obtain versatile pyridazines containing an ester group at position 6 as a point of divergence. The latter steps involved the synthesis of pyridazines 9.4 with a ketone group at position 6. Towards this aim, different methods of cyclization techniques were applied which led to the formation of previously not known biheterocyclic compounds. This novel methodology provided an attractive synthesis for fused pyridazines derivatives (9.5, 9.6, 9.7, 9.8).20 The synthesis of functionalised pyridazines 10.4 (Scheme 10) proceeded via a diaza-Wittig reaction (10.3 to 10.4, step b.) affording a convenient and safer method for the synthesis of nitrogen heterocycles. Scheme 10: Synthesis of pyridazines 3.3. Direct imine acylation for heterocyclic synthesis Much attention has been focussed on the synthesis of diverse heterocyclic structure to advance the discovery of novel lead compounds for pharmaceutical discovery. A particularly useful approach is the formation of N-acyliminium ions from the acylation of imines with acid halides and anhydrides. This is a well-known reaction but very little work has previously been carried out to show the full potential of these ring closure reactions.23 Unsworth et. al. has provided a neat ring closing reaction (Scheme 11) by using propylphosphonic acid anhydride 11.3 (T3P) and NEt(iPr)2 for the coupling of aliphatic acids 11.2 (containing oxygen, nitrogen and sulphur nucleophiles) to imines 11.1. This will generate N-acyliminium ions 11.4 that can easily be trapped intramolecularly by the nucleophilic substituents that are present on the aliphatic acid fragment to form 11.5. Scheme 11: Ring closing reaction for heterocyclic synthesis This methodology has been used by Unsworth for the synthesis of the natural product evodiamine (Figure 6).24 Figure 6: Synthesis of evodiamine 4. Domino reactions A process that involves two or more bond-forming transformations that can take place under the same reaction conditions without additional reagents and/or catalysts, are considered to be domino/tandem reaction.25 In the past decades, synthesis of heterocyclic compounds through new domino reactions has attracted many researches and is still an expanding area.26 The idea of building simple and complex heterocycles starting from very easy and reasonable building blocks using a ‘single pot’ reaction with consecutive transformation taking place, is an attractive tool for synthetic chemists, especially if the synthesis can be used to create multiple stereogenic centres.26, 27 This ‘one pot’ strategy has many advantages; reduction of solvent, waste production, reaction time and atom economy28, all of which are important for developing a more sustainable chemistry. One single reaction can potentially convert an inexpensive material to a highly complex, biologically active heterocyclic molecule.26, 29 For many years the research groups of Valotti and Arcadi have focussed their interests in developing a new synthetic route for the construction of nitrogen-containing heterocycles starting from alkyne derivatives.30 They have focused most of their attention on the synthesis of nitrogen containing heterocycles by the condensation of ketoalkynes with ammonia.30 Examples of these are shown below in Scheme 12 and show the 5-exo-dig cyclisation reactions of 4-pentynones 12.1 to synthesise polysubstituted and joined pyrrole derivatives 12.2, Ketoalkyne moiety 12.5 in an aromatic framework would allow a 6-endo-dig cyclisation of 5-acetyl-4-alkynylthiazoles 12.6 and 2-acyl-3-alkynylindoles 12.7 to pyrido[3,4-c]thiazole and pyrido[3,4-b]indoles 12.8.31, 32 Scheme 12: Synthesis of pyrrole, pyridine and indole nitrogen containing heterocycles Another example of a tandem reaction for heterocyclic synthesis is the intermolecular 1,3-dipolar cycloaddition of nitrones for the formation of cyclic isooxazolidines ( Scheme 13). For example an interesting method has been developed for the generation of the cyclic isooxazolidines frameworks by using cheap and accessible starting material, such as Amaryllicaceae alkaloids, through a 1,2-prototropic shift of oximes. Scheme 13: Tandem reaction for cyclic isooxazolidines Wildman observed that the reaction of 6-hydroxybuphandidrine with hydroxylamine produced a cycloadduct; the reaction occurs by the formation of an intermediate oxime that then undergoes a subsequent 1,2-prototropic shift to give the nitrile oxide that then undergoes an intramolecular [1,3]-dipolar cycloaddition reaction. 5. Indoles In both nature and drug discovery, a common nitrogen containing heterocycle is indole and its derivatives. These naturally occurring molecules are present in a range of compounds (Figure 7) such as amino acids (tryptophan) and hormones (melatonin) and many others.33 Figure 7: Naturally occurring indoles As indoles are structural components of a large number of biologically active natural compounds, their synthesis and functionalization has been heavily researched, and is a crucial step in the preparation of many pharmaceutical compounds.33 Below, in Figure 8, are a couple of examples of indole containing pharmaceuticals and their applications; Sumatripan used for the treatment of migraine and Arbidol as an antiviral drug.34 Figure 8: Indole containing pharmaceutical compounds Another potential application for indoles is the possible use of indole derived nitrones as spin traps which can be employed as free radical probes for the identification of radicals in chemical and biological systems.35, 36 The pyrroline based 5,5-dimethyl-pyrroline N-oxide (DMPO) followed by the 5-carbamoyl-5-methyl-l-pyrroline N-oxide (AMPO) have often been used as nitrene spin traps in the past years (Figure 9).37 The use of spin trapping has gained attention in the recent years and it is currently being used in the investigation of reactive intermediates in the areas of fuel cell research, nanotechnology, catalysis, environmental remediation and photodynamic therapy using electron paramagnetic resonance (EPR).38 Figure 9: DMPO and AMPO spin traps The main disadvantages with many spin trap nitrones, for example DMPO, is the formation of secondary EPR signals; caused by the formation of other radical species caused by the instability by hydrolysis, decomposition and various other side reactions.37 Also, the slow reactivity of the superoxide radical anion to the nitrones and the short half-life of the spin adducts together, with slow rate of passive diffusion through the cell membran decreases their application in the human body as O2. – probes, unless further modifications can be carried out.38 Variants of the DMPO that contain indole moieties are 1,1,3-trimethyl-1H-isoindole-N-oxide (TMINO) and 1,1-dimethyl-3-(trifluoromethyl)-1H-isoindole-N-oxide(3-TF-TMINO) (Figure 10) which offer more stability to the oxygen radical adduct.37 Figure 10: Novel spin trap nitrones 6. Isoindolinone and Isoindoline Novel structures related to indoles such as isoindoline and isoindolinone compounds (Figure 11) are still relatively unexplored and have only begun to be explored over the past few years. Figure 11: Isoindoline and Isoindolinone Both of these structures have attracted a large amount of attention as pharmacophores due to their potential physiological and chemotherapeutic activity. These bicyclic models moieties have found a large importance as intermediates in the synthesis of various dugs and natural products.39 The more stable isoindolinones in particular demonstrate fascinting biological properties40, 41 as part of biologically active natural products such as magallanesine as well as drug candidates such as pagoclone shown in Figure 12.42 Figure 12: Isoindolinones as drug candidates The biological activity of isoindolinones has been utilised for the preparation of drugs for treatments in a wide range of diseases (Figure 13) such as: diabetes treatment, anti-inflammatory, anti-hypertensive, antipsychotic agents, for the modulation of dopamine D receptor, inhibitors of amyloid protein aggregation for the treatment of Alzheimer, selective antagonist of Essential Thromobocythemia (ET) diseases related to the heart and the lungs, melanocortin subtype-4-receptor in the targeting of weight disorder and sexual dysfunction43 and as antileukemic agents.42, 44-46 Figure 13: Isoindolines as drug candidates There have been several methods employed traditionally for the synthesis of these compounds based on use of a wide range of transformation, such as Diels-Alder, Grignard reagents, reductions, Wittig reactions and photochemical reactions. An example of one of them follows in Scheme 14. Scheme 14: One pot synthesis of isoindolinones The traditional routes are usually complex and have proved to be very unsatisfactory due to the low yields and the expensive starting material.39 Most approaches do not provide a large compatibility with many functional groups and suffer from a lack of generality.38, 42 New approaches have arisen in the past decades involving palladium chemistry and lithiation procedure for the synthesis of substituted isoindolinones that have proved to be easier to handle. An example of this is shown below (Scheme 15).47 Scheme 15: Lithiation and substitution

Terrorism Essay -- Terrorists War Iraq

Terrorism Terrorism†¦This is a very common word in today’s society. What does it mean? Or more importantly how do â€Å"we† prevent it and if necessary combat it? The word most commonly used to explain this is counter terrorism, but is also known as anti-terrorism. The military is a great force in combating terrorism with specialist groups in nearly each branch of the armed forces. Prior to the September 11 attacks the United States Armed Forces worked hand in hand with NATO and the United Nations combating terror. However after these attacks, the United States Military has become a widely utilized entity on fighting terrorism.   Ã‚  Ã‚  Ã‚  Ã‚  Before even discussing anything about terrorism you have to have a broad understand of what it is. The definition of terrorism is very complex, mostly because there is no real definition. According to Dr. Groskin, terrorism is â€Å"the use or threat of using violence and force to achieve political objectives using methods which represent violations of criminal laws.† He also states that it is the â€Å"motives that lie behind the acts which serve to distinguish terrorism from aberrant, seemingly irrational, mindless, senseless violence.† When looking at a â€Å"terrorist† act the use of fear, demands for change, selection of victims, and how likely it is to attract attention all have to be closely examined to determine if it is truly what it seems.   Ã‚  Ã‚  Ã‚  Ã‚  Terrorist attacks can range from chemical, biological, nuclear, suicidal, kidnapping, and more. They ar...

Communications between Parents and Children Essay -- Family Communicat

Healthy family relationships depend on healthy communications there are many ways and times to practice and teach good communication to children. There are many times that without good communication, the parent-child relationship suffers and sometimes ends abruptly. Good communication skills should be taught from birth and continue throughout adulthood. In order to have a good parent/child relationship with open communication, there must also be mutual respect. If there is no respect, the lines of communication will falter. Tom Schwartz states that he knows of â€Å"many cases where children are raised in an atmosphere of dark secrecy about both the matriarchal and patriarchal parts of their families. They grow up with a sense that something must be wrong but fear discussing this with their parents.† (5) Most people have grown up with family secrets, but some secrets can destroy a family. The act of hiding the secret(s) provides an excuse to limit self-disclosure, and reacts negatively on one’s self-esteem. â€Å"Good communication helps keep a family running smoothly and prevents misunderstandings from escalating into conflict or from being buried unresolved.† (Feiden, 68) When these become extremely limited or negative, there is an increased chance of a separation and possible ending of the relationship. The end of the relationship could mean that parent and child no longer talk, or they are forcibly separated for their own health in extreme cases. Unfortunately, â€Å"emotional health can be passed down from generation to generation just as easily as abuse and dysfunction,† (Bloch, 7) making such dysfunctions of communications a continuous process. In cases like this, communication is crucial. The secrets should be shared within the family. ... ...heir lives. Works Cited Bay, Willow, Talking to your Kids in Tough Times, New York: Warner books, 2003 Berenstain, Stan & Jan, What Your Parents Never Told You about Being a Mom or Dad, New York: Crown Publishers, Inc., 1995 Bloch, Douglas, Positive Self-Talk For Children, New York: Bantam Books, 1993 Children’s Defense Fund. â€Å"The state of America’s children 2008† 2009: 80 Pages. October 30, 2009 . Feiden, Karyn, Raising Responsible Kids, New York: Prentice Hall Press, 1991 Schwartz, PH.D., Allen, â€Å"Family Secrets†, April 25, 2007: 8 pages October 30, 2009, Sturges, Tom, Parking Lot Rules & 75 Other Ideas for Raising Amazing Children, New York: Ballantine Books, 2008

Negative effects of technology

Technology has had a negative effect on people's lives. Technology has distracted kids, caused accidents, and health problems. It's actually kind of sad. Technology has negatively affected kids In such a huge way, especially In schools. Most kids claim they're bored so they pull out their cell phones or Pods. Their attention span isn't but so big, so they tend to get distracted easily by fumbling with their phones and playing games. This is why phones aren't allowed in most schools today.Reason being is because teachers find it very disrespectful and rude when they are trying to teach and students aren't learning or listening. The most commonly used technology today is the cell phone. Cell phones cause so many things to happen. Most car accidents are cause by being on cell phones. In a teens mind they think sending this one word or message Is wont hurt while they're driving but In reality It does. They have so many commercials about the consequences of testing and driving. Most teens Just don't listen.It's not Just the teens either, It's even the adults that text and drive. Adults are supposed to be role models for the younger generation not the opposite. Most people don't know that technology causes health problems. Being on a cell phone for too long and having so close to a person's eyes can mess up their vision. Also talking on the phone can cause cancer. Of course a person wouldn't get cancer just by one phone call, it would take some time. Another major health problem caused by technology is Carpal tunnel syndrome.Testing excessively can damage the nerves in someone's hands and fingers, causing numbness, tingling, and weakness. These are Just a few health problems caused by technology. It's Just amazing how something created by man can cause so many negative things to happen. Just by being on a cell phone while driving could cost someone their life, having a cell phone or Pod out could cost a child's education, or even testing could cause permanent damage. Technology has negative effects on people's lives daily. Negative effects of technology By redoneTechnology has negatively affected kids in such a huge way, especially in schools. Most kids claim they're bored so they pull out their cell phones or ‘pods. Their teens mind they think sending this one word or message is won't hurt while they're driving but in reality it does. They have so many commercials about the consequences of testing and driving. Most teens Just don't listen. It's not Just the teens either, it's even the adults that text and drive. Negative Effects of Technology Technology can not only negatively effect ones physical health, privacy but there are also emotional and psychological effects which can be disastrous. ’ Internet addiction is a psychological dependency on using the internet regardless of the type of activity once logged on’ . caplan 02. ‘a cycle of five successive and interdependent stages’. young01. Discovery, experimentation, escalation, compulsion, and hope lessness lead the person through a series of cause and effect emotions.. yong. 08 describes a person with a tendancy to avoid life problems by medicating him self with the internet. Lonely people with low self esteem choose emotional relationships with cyberspace frinds. Becase ‘real’ individuals rejecting them is no longer possible, the person feels safe and confident in his world of denial. abs 08. Bisides social awkwardness and isolation the psychologically dependant person is one who tends to avoid real life situation and problems. abs. 08.. speaks of increasing absence from work as a woman’s online sexual fantasies grew into an obcession . to feel angry, jealous, rejected and abandoned as they experience the emotional pain of an online affair by their partner. Conflict and emotional cost is also a result of poker playing online. chb. 00. states that intense players played 3 times longer than the majority, in one study.. Other life activities would be effected more and more. An incrase in emotional pain resulting. However, emotional pain is not only caused by the individual’s online behavior but also the financial strain of the addiction. Chb09.. states that in its study of online poker players, most player moderated their behavior based on wins and losses. 1 the most involved players. However, did not this would indicate a high financial strain when these players experienced loss. Nms07 study on problem gambling on the internet found that 42. 7% of internet gamblers were problem gamblers. b. Another emotional result of online gambling is the altered perception of the gambler making him less aware of financial risks. nmss07.. The predictable remorse and guilt fallows the loss of money. Many online gaming sites give the impussion that pay out rates of demo session apply to regular play which is untrue. Demo sessions also will set up an imagined ‘big win’ which the article states sets a person up for problem gambling in the future. Aa ther are risk factors for those who are psychologically, vulnerable to becoming addicted to online sex. abs08. millions of adult sites abs08 are available 24 hours a day, 7 days aweek. The underlying factor of accessible ‘free’ sex and gambling contributes to addiction for those particular people. abs. abs.. Besides easy access, being anonymous also increases addictive tendancies for those most prone to be effected. Online users can experiment freely and confidently in the virtual world. Gamblers use electronic means to pay for services making the financial losses seem less real. Comm. With the rapid changes in technology comes both positive and negative results. Certain personality types seem more prone to online addicions to sex. Poker , and gambling. The availability of the internet and the relatively inexpensive world of excitement and pretending, seems to be an unpleasant reality makes fantasy even more attractive. The high emotional price for the addict and his loud ones, is just beginning to be revealed.

Pakistan Study

Ar-Raheeq Al-Makhtum (The Sealed Nectar) By Saifur Rahman al-Mubarakpuri CONTENTS Location and nature of Arab Tribes Location of the Arabs Arab Tribes Rulership and Princeship among the Arabs Rulership in Yemen Rulership in Heerah Rulership in Geographical Syria Rulership in Hijaz T he Reasons of this war have been illustrated in three versions Rulership in Pan-Arabia The political situation Religions of the Arabs The Religious situation Aspects of Pre-Islamic Arabian Society Social life of the Arabs The Economic Situation The Lineage and Family of Muhammad (Peace be upon him)The prophetic Family Muhammad’s Birth and Forty years prior Prophethood His Birth B abyhood B ack to his passionate Mother To His compassionate Grandfather Bahira, the Monk The Sacrilegious wars Al-Fudoul confederacy Muhammad’s Early Job His Marriage to Khadijah Rebuilding Al-Ka‘bah and the Arbitration Issue A Rapid Review of Muhammad’s Biography before commissioning of the Prophethood In the Shade of the Message and Prophethood In the Cave of Hira’ Gabriel brings down the Revelation Interruption of Revelation Once more, Gabriel brings Allah’s RevelationS ome details pertinent to the successive stages of Revelation Proclaiming Allah, the All-High; and the Immediate Constituents Phases and stages of the call The First Stage Strife in the Way of the Call Three years of Secret Call The Early Converts As-Salat (the Prayer) T he Quraishites learn about the Call The Second Phase, Open Preaching First Revelation regarding the Preaching Calling the Closest Kinspeople On Mount As -Safa Shouting the Truth and the Polytheists’ Reaction An Advisory Council to debar Pilgrims from Muhammad’s Call Attempts made to check the Onward March of Islam Persecutions The House of Al-Arqum The First Migration to Abyssinia (Ethiopia) Quraish’s Machination against the Emigrants Once more Quraish approaches Abu Talib The Tyrants’ Decision to kill th e Prophet (Peace be upon him) The Conversion of Hamzah bin ‘Abdul-Muttalib The Conversion of ‘Umar bin Al-Khattab Q uraish’s Representative negotiates with the Messenger of Allah (Peace be upon him) Abu Talib assmbles Bani Hashim and Bani Al-Muttalib General Social Boycott A Pact of Injustice and Aggression The Final Phase of the Diplomacy of Negotiation The Year of Grief Abu Talib’s DeathK hadijah passes away to the Mercy of Allah H is Marriage to Sawdah (May be please with her) in Shawwal, the tenth year of Prophethood Factors inspiring patience and perserverance The Third Phase Calling unto Is lam beyond Makkah Islam being introduced to Arabian Tribes and Individuals Hope inspiring Breezes from the Madinese Marriage of the Prophet (Peace be upon him) to Aisha (May Allah be please with her) Al-Isra’ and Al-Mir‘raj The First ‘Aqabah Pledge The Muslim Envoy in Madinah T he Second ‘Aqabah Pledge The Vanguard of Migration (in the Caus e of Allah) In An-Nadwah (Council) HouseThe Parliament of Quraish Migration of the Prophet (Peace be upon him) Life in Madinah The First Phase †¦ The Status Quo in Madinah at the Time of Emigration A New Society being built A Charter of Islamic Alliance A Cooperation and Non-Aggression P act with the Jews The Prophet on the Battlefield Pre-Badr Missions and Invasions The Battle of Badr – The First Decisive Battle in the History of Islam Reason of the Battle Some Significant Instances of Devotion Reaction in Makkah Madinah receives the News of Victory The Battle of Badr in its Qur’anic Context The Military Activities between Badr and UhudAl-Kudr Invasion An Attempt on the Life of the Prophet (Peace be upon him) Invasion of Bani Qainuqa‘ T he Qainuqa‘ Jews breach the Covenant As-Sawiq Invasion Dhi Amr Invasion Ka‘b bin Al-Ashraf, killed 3 The Invasion of Buhran Z aid bin Harithah leads a Compaign on the Trade Routes of Quraish The Battle of Uhud A Consultation Assembly for a Defence Plan Dividing the Islamic Army into phalanxes and Departure to the Battlefield Para ding the Army P assing the Night between Uhud and Madinah The Rebellion of ‘Abdullah bin Ubai and his Followers The Remainder of the Islamic Army are on the Move to UhudThe Defence Plan The Messenger of Allah (Peace b e upon him) implants the Spirit of Bravery among his Armed Forces Recruitment of the Makkan Army Political Manoeuvres of Quraish T he effort of Quraishite women at waging the Zeal of Men T he Combat A ssassination of Asadullah (the Lion of Allah) Hamzah bin ‘Abdul Muttalib Bringing the Situation under Control From his wife’s lap to Sword -fights and Sorrows The Contribution of the Archers squad to the Battle. The Archers’s Fatal Mistake The Most Awkward Hour in the Messenger’s Life Multilation of the Martyrs Burial of the Martyrs Hamra’ Al-Asad InvasionT he Observations of the Noble Qur’an on the Battle o f Uhud L essons and Moralities Military Platoons and Missions between the Battle of Uhud and the Battle of the Confederates Abi Salamah Mission An Errand led by ‘Abdullah bin Unais The Event of Ar-Raji‘ The Tragedy of Ma‘una Well Bani An-Nadeer Invasion The Invasion of Najd The Invasion of Badr, the Second The Invasion of Doumat Al-Jaudal Al-Ahzab (the Confederates) Invasion Invading Banu Quraiza Military Activities continued Bani Lihyan Invasion E xpeditions and Delegations continued Bani Al-Mustaliq (Muraisi‘) Ghazwah Sha‘ban 6 Hijri The treacherous Role of the HypocritesP rior to the Bani Al-Mustaliq Ghazwah T he wicked Role they played in the Course of the Ghazwah of Bani Al-Mustaliq The Slander Affair Delegations and Expeditions following Al-Muraisi‘ Ghazwah Al-Hudaibiyah Treaty (Dhul Qu‘dah 6 A. H. ) Al-Hudaibiya Treaty: Socio Political Impact The Second Stage A N ew Phase of Islamic Action T he Prophet’s Plans to spread the Mes sage of Islam to beyond Arabia A Deputation to Abyssinia (Ethiopia) L etter to the Vicegerent of Egypt, called Muqawqas A Letter to chosroes, Emperor of Persia The Envoy to Caesar, King of Rome 4 A Letter to Mundhir bin Sawa, Governor of BahrainA Letter to Haudha bin ‘Ali, Governor of Yamama A Letter to Harith bin Abi Shamir Al-Ghassani, King of Damascus A Letter to the King of ‘Oman, Jaifer, and his Bother ‘Abd Al-Jalandi P ost-Hudaibiyah Hostilities Dhu Qarad Invasion The Conquest of Khaibar (in Moharram, 7 A. H. ) The Actual operation begins T he Second Part of Khaibar Conquered N egotiations Distribution of Spoils Sporadic Invasions The Expedition called Dhat-ur-Riqa‘ (in the year 7 A. H. ) T he Compensatory ‘Umrah (Lesser Pilgrimage) The Battle of Mu’tah Dhat As-Salasil Compaign Khadrah Campaign T he Conquest of Makkah Pre-conquest EventsP reparations for the Attach on Makkah, and the Prophet’s Attempt at imposing a News Black-out The Third Stage Hunain Ghazwah The Enemy’s march and their Encampment at Awtas T he war-experienced Man wongs the Leader’s Judgement R econnoitering the Weapons of the Messenger of Allah(Peace be upon him) R econnoitering the Enemy’s Weapons The Messenger of Allah (peace be upon him) leaves Makkah for Hunain The Islamic Army stunned the Archers and the Attackers Muslims’ return to the Battlefield, and the fierceness of the Fight R everse of Fortunes and the Enemy’s utter Defeat Hot pursuit of the Enemy Ta’if CompaignThe Distribution of the Booty at al-Ji‘ranah The Helpers (Al-Ansar) are furious at the Messenger of Allah (Peace be upon him) Arrival of the Hawazin Delegation Lesser Pilgrimage (Al-‘Umrah ) to Makkah and leaving for Madinah M issions and Platoons After the Conquest T he Platoons The Invasion of Tabuk in Rajab, in the year 9 A. H. The underlying Reasons G eneral News about the Byzantines and Ghassanide Preparations for W ar P articular News about the Byzantine and Ghassanide preparations for War The Muslim Army is leaving for Tabuk The Army of Islam at Tabuk Returning to Madinah T he People Who lagged BehindThe Invasion of Tabuk and its Far-Reaching Ramifications The Qur’anic Verses Relating to this Invasion Some Important Events that featured that Year Abu Bakr performs the Pilgrimage A Meditation on the Ghazawat People embrace the Religion of Allah in Large Crowds T he Delegations The Success and Impact of the Call The Farewell Pilgrimage 5 The Last Expeditions The Journey to Allah, the Sublime Symptoms of Farewell T he Start of the Disease T he Last Week F ive days before death F our days before his death A Day or Two prior to Death A Day before his Death The Last day Alive T he Prophet (Peace be upon him) breathes his LastThe companions’ concern over the Prophet’s Death Umar’s Attitude Abu Bakr’s Attitude B urial and Farewell Preparations to his Honourable Body The Prophetic Household The Prophet (Peace be upon him), Attributes and Manners Beauty of creation The perfection of Soul and Nobility 6 Location and Nature of Arab Tribes Beyond a shadow of doubt, the biography of Prophet Muhammad (Peace be upon him) manifestedly represents an exhaustive embodiment of the sublime Divine Message that he communicated in order to deliver the human race from the swamp of darkness and polytheism to the paradise of light and monotheism.An image, authentic as well as comprehensive, of this Message is therefore only attainable through careful study and profound analysis of both backgrounds and issues of such a biography. In view of this, a whole chapter is here introduced about the nature and development of Arab tribes prior to Islam as well as the circumstantial environment that enwrapped the Prophet’s mission. LOCATION OF THE ARABS: L inguistically, the word â€Å"Arab† means deserts and waste barren land well-nigh waterless and treeless.E ver since the dawn of history, the Arabian Peninsula and its people have been called as such. The Arabian Peninsula is enclosed in the west by the Red Sea and Sinai, in the east by the Arabian Gulf, in the south by the Arabian Sea, which is an extension of the Indian Ocean, and in the north by old Syria and part of Iraq. The area is estimated between a million and a million and a quarter square miles. Thanks to its geographical position, the peninsula has always maintained great importance..Considering its internal setting, it is mostly deserts and sandy places, which has rendered it inaccessible to foreigners and invaders, and allowed its people complete liberty and independence through the ages, despite the presence of two neighbouring great empires. Its external setting, on the other hand, caused it to be the centre of the old world and provided it with sea and land links with most nations at the time. Thanks to this strategic position the Arabian Peninsula had become the centre for trade, culture, religion and art. ARAB TRIBES:Arab kinfolks have been divided according to lineage into three groups: Perishing Arabs: The ancient Arabs, of whose history little is known, and of whom were ‘Ad, Thamud, Tasam, Jadis, Emlaq, and others. Pure Arabs: Who originated from the progeny of Ya‘rub bin Yashjub bin Qahtan. They were also called Qahtanian Arabs. Arabized Arabs: Who originated from the progeny of Ishmael. They were also called ‘Adnanian Arabs. The pure Arabs – the people of Qahtan – originally lived in Yemen and comprised many tribes, two of which were very famous: 1. Himyar: The most famous of whose septs were Zaid Al-Jamhur, Quda‘a and Sakasic. . Kahlan: The most famous of whose septs were Hamdan, Anmar, Tai’, Mudhhij, Kinda, Lakhm, Judham, Azd, Aws, Khazraj and the descendants of Jafna — the kings of old Syria. Kahlan septs emigrated from Yemen to dwell in the different parts of the Arabian Peninsula prior to the Great Flood (Sail Al-‘Arim of Ma’rib Dam), due to the failure of trade under the Roman pressure and domain on both sea and land trade routes following Roman occupation of Egypt and Syria. Naturally enough, the competition between Kahlan and Himyar led to the evacuation of the first and the settlement of the second in Yemen.THE EMIGRATING SEPTS OF KAHLAN CAN BE INTO FOUR GROUPS: 1 . Azd: Who, under the leadership of ‘Imran bin ‘Amr Muzaiqba’, wandered in Yemen, sent pioneers and finally headed northwards. Details of their emigration can be summed up as follows: 7 2. Tha‘labah bin ‘Amr left his tribe Al-Azd for Hijaz and dwelt between Tha‘labiyah and Dhi Qar. When he gained strength, he headed for Madinah where he stayed. Of his seed are Aws and Khazraj, sons of Haritha bin Tha‘labah. Haritha bin ‘Amr, known as Khuza‘a, wandered with his folks in Hijaz until they came to Mar Az-Zahran.Later, they conquered the Haram, and settled in Makkah after having driven away its people, the tribe of Jurhum. ‘Imran bin ‘Amr and his folks went to ‘Oman where they established the tribe of Azd whose children inhabited Tihama and were known as Azd-of-Shanu’a. Jafna bin ‘Amr and his family, headed for Syria where he settled and initiated the kingdom of Ghassan who was so named after a spring of water, in Hijaz, where they s topped on their way to Syria. 2. Lakhm and Judham: Of whom was Nasr bin Rabi‘a, father of Manadhira, Kings of Heerah. 3.Banu Tai’: Who also emigrated northwards to settle by the so- called Aja and Salma Mountains which were consequently named as Tai’ Mountain s. 4. Kinda: Who dwelt in Bahrain but were expelled to Hadramout and Najd where they instituted a powerful government but not for long , for the whole tribe soon faded away. †¢ Another tribe of Himyar, known as Quda‘a, also left Yemen and dwelt in Samawa semidesert on t he borders of Iraq. The Arabized Arabs go back in ancestry to their great grandfather Abraham (Peace be upon him) from a town called â€Å"Ar† near Kufa on the west bank of the Euphrates in Iraq.Excavations brought to light great details of the town, Abraham’s family, and the prevalent religions and social circumstances. It is known that Abrahaml (Peace be upon him) eft Ar for Harran and then for Palestine, which he made headquarters for his Message. He wandered all over the area. When he went to E gypt, the Pharaoh tried to do evil to his wife Sarah, but Allah saved her and the Pharaoh’s wicked scheme recoiled on him. He thus came to realize her strong attachment to Allah, and, in acknowledgment of her grace, the Pharaoh rendered his daughter Hagar at Sarah’s service, but Sarah gave Hagar to Abraham as a wife.Abraham returned to Palestine where Hagar gave birth to Ishmael. Sarah became so jealous of Hagar that she forced Abraham to send Hagar and her bab y away to a plantless valley on a small hill in Hijaz, by the Sacred House, exposed to the wearing of floods coming right and left. He chose for them a place under a lofty tree above Zamzam near the upper side of the Mosque in Makkah where neither people nor water was available, and went back to Pale stine leaving with his wife and baby a leather case with some dates and a pot of water.Not before long, they ran out of both food and water, but thanks to Allah’s favour water gushed forth to sustain them for sometime. The whole story of Zamzam spring is already known to everybody. Another Yemeni tribe – Jurhum the Second – came and lived in Makkah upon Hagar’s permission, after being said to have lived in the valleys around Makkah. It is mentioned in the Sahih Al-Bukhari that this tribe came to Makkah before Ishmael was a young man while they had passed through that valley long before this event. Abraham used to go to Makkah every now and then to see his wif e and son.The number of these journeys is still unknown, but authentic historical resources spoke of four ones. Allah, the Sublime, stated in the Noble Qur’an that He had Abraham see, in his dream, that he slaughtered his son Ishmael, and therefore Abraham stood up to fulfill His Order: †¢ â€Å"Then, when they had both submitted themselves (to the Will of Allah), and he had laid him prostrate on his forehead (or on the side of his forehead for slaughtering); and We called out to him: â€Å"O Abraham! You have fulfilled the dream (vision)! † Verily!Thus do we reward the Muhsinun (good-doers, who perform good deeds totally for Allah’s sake only, without any show off or to gain praise or fame, etc. and do them in accordance to Allah’s Orders). Verily, that indeed was a manifest trial — and We ransomed him with a great sacrifice (i. e. a ram)† [37:103-107] 8 It is mentioned in the Genesis that Ishmael was thirteen years older than his brot her Ishaq. The sequence of the story of the sacrifice of Ishmael shows that it really happened before Ishaq’s birth, and that Allah’s Promise to give Abraham another son, Ishaq, came a fter narration of the whole story.This story spoke of one journey – at least – before Ishmael became a young man. Al-Bukhari, on the authority of Ibn ‘Abbas, reported the other three journeys; a summary of which goes as follows: When Ishmael became a yo ung man, he learned Arabic at the hand of the tribe of Jurhum, who loved him with great admiration and gave him one of their women as a wife, soon after his mother died. Having wanted to see his wife and son again, Abraham came to Makkah, Ishmael’s marriage, but he didn’t find him at home. He asked Ishmael’s wife about her husband and how they were doing.She complained of poverty, so he asked her to tell Ishmael to change his doorstep. Ishmael understood the message, divorced his wife and got marri ed to the daughter of Mudad bin ‘Amr, chief of the tribe of Jurhum. Once more, Abraham came to see his son, but again didn’t find him at home. He asked his new wife the same previous question, to which she thanked Allah. Abraham asked her to tell Ishmael to keep his doorstep (i. e. to keep her as wife) and went back to Palestine. A third time, Abraham came to Makkah to find Ishmael sharpening an arrow under a lofty tree near Zamzam.The meeting, after a very long journey of separation, was very touching for a father so affectionate and a so dutiful and righteous son. This time, father and son built Al-Ka‘bah and raised its pillars, and Abraham, in compliance with Allah’s Commandment, called unto people to make pilgrimage to it. By the grace of Allah, Ishmael had twelve sons from the daughter of Mudad, whose names were Nabet, Qidar, Edbael, Mebsham, Mishma’, Duma, Micha, Hudud, Yetma, Yetour, Nafis and Qidman, and who ultimately formed twelve tribes in habiting Makkah and trading between Yemen, geographical Syria and Egypt.Later on, these tribes spread all over, and even outside, the peninsula. All their tidings went into oblivion except for the descendants of Nabet and Qidar. The Nabeteans – sons of Nabet – established a flourishing civilization in the north of Hijaz, they instituted a powerful government which spread out its domain over all neighbouring tribes, and made Petra their capital. Nobody dared challenge their authority until the Romans came and managed to eliminate their kingdom. After extensive research and painstaking investigation, Mr.Sulaiman An-Nadwi came to the conclusion that the Ghassanide kings, along with the Aws and Khazraj were not likely to be Qahtanians but rather Nabeteans. Descendants of Qidar, the son of Ishmael, lived long in Makkah increasing in number, of them issued ‘Adnan and son Ma‘ad, to whom ‘Adnanian Arabs traced back their ancestry. ‘Adnan is the twenty-f irst grandfather in the series of the Prophetic ancestry. It was said that whenever Prophet Muhammad Oai Caaa Uaia ? Oaa spoke of his ancestry he would stop at ‘Adnan and say: â€Å"Genealogists tell lies† and did not go farther than him.A group of scholars, however, favoured the probability of going beyond ‘Adnan attaching no significance to the aforementioned Prophetic Hadith. They went on to say that there were exactly forty fathers between ‘Adnan and Abraham (Peace be upon them). Nizar, Ma‘ad’s only son , had four sons who branched out into four great tribes; Eyad, Anmar, Rabi‘a and Mudar. These last two sub-branched into several septs. Rabi‘a fathered Asad, ‘Anazah, ‘Abdul Qais, and Wa’il’s two sons (Bakr and Taghlib), Hanifa and many others. Mudar tribes branched out into two great divisions: Qais ‘Ailan bin Mudar and septs of Elias bin Mudar.Of Qais ‘Ailan were the Banu Saleem, Banu Hawazi n, and Banu Ghatafan of whom descended ‘Abs, Zubyan, Ashja‘ and Ghani bin A‘sur. Of Elias bin Mudar were Tamim bin Murra, Hudhail bin Mudrika, Banu Asad bin Khuzaimah and septs of Kinana bin Khuzaimah, of whom came Quraish, the descendants of Fahr bin Malik bin An-Nadr bin Kinana. Quraish branched out into various tribes, the most famous of whom were Jumah, Sahm, ‘Adi, Makhzum, Tayim, Zahra and the three septs of Qusai bin Kilab: ‘Abdud-Dar bin Qusai, Asad bin ‘Abdul ‘Uzza bin Qusai and ‘Abd Manaf bin Qusai. Abd Manaf branched out into four tribes: ‘Abd Shams, Nawfal, Muttalib and Hashim. It is, however, from the family of Hashim that Allah selected Prophet Muhammad bin ‘Abdullah bin ‘Abdul-Muttalib bin Hashim (Peace be upon him). Prophet Mu hammad (Peace be upon him) said: †¢ â€Å"Allah selected Ishmael from the sons of Abraham, Kinana from the sons of Ishmael, Quraish from the sons of Kinana, Hashim from the sons of Quraish and He selected me from the sons of Hashim. † Al-‘Abbas bin ‘Abdul-Muttalib quoted the Messenger of Allah (Peace be upon him) as saying: 9 †¢ Allah created mankind and chose me from the best whereof, He chose the tribes and selected me from the best whereof; and He chose families and selected me from the best whereof. I am the very best in person and family. † Having increased in number, children of ‘Adnan, in pursuit of pastures and water, spread out over various parts of Arabia. The tribe of ‘Abdul Qais, together with some septs of Bakr bin Wa’il and Tamim, emigrated to Bahrain where they dwelt. Banu Hanifa bin Sa‘b bin Ali bin Bakr went to settle in Hijr, the capital of Yamama. All the tribes of Bakr bin Wa’il lived in an area of land which ncluded Yamama, Bahrain, Saif Kazima, the sea shore, the outer borders of Iraq, Ablah and Hait. Most of the tribe of Taghlib lived in the Euphrates area while some of them lived with Bakr. Banu Tamim lived in Basra semi-desert. Banu Saleem lived in the vicinity of Madinah on the land stretching from Wadi Al-Qura to Khaibar onwards to the eastern mountains to Harrah. Thaqif dwelt in Ta’if and Hawazin east of Makkah near Autas on the road from Makkah to Basra. Banu Asad lived on the land east of Taima’ and west of Kufa, while family of Tai’ lived between Banu Asad and Taima’. They were five -day-walk far from Kufa.Zubyan inhabited the plot of and between Taima’ and Hawran. Some septs of Kinana lived in Tihama, while septs of Quraish dwelt in Makkah and its suburbs. Quraish remained completely disunited until Qusai bin Kilab managed to rally their ranks on honourable terms attaching major prominence to their status and importance. 10 RULERSHIP AND PRINCESHIPAMONG THE ARABS W hen talking about the Arabs before Islam,we deem it necessary to draw a mini-picture of the history of rulership, princeship, sectarianism an d the religious dominations of the Arabs, so as to facilitate the understanding of emergent circumstances when Islam appeared.When the sun of Islam rose, rulers of Arabia were of two kinds: crowned kings, who were in fact not independent; and heads of tribes and clans, who enjoyed the same authorities and privileges possessed by crowned kings and were mostly independent, though some of whom could have shown some kind of submission to a crowned king. The crowned kings were only those of Yemen, Heerah and Ghassan. All other rulers of Arabia were non-crowned. RULERSHIP IN YEMEN: T he folks of Sheba were one of the oldest nations of the pure Arabs, who lived in Yemen. Excavations at â€Å"Or† brought to light their existence twenty ive centuries B. C. Their civilization flourished, and their domain spread eleven centuries B. C. It is possible to divide their ages according to the following estimation: 1. The centuries before 650 B. C. , during which their kings were called  "Makrib Sheba†. Their capital was â€Å"Sarwah†, also known as â€Å"Khriba†, whose ruins lie in a spot, a day’s walk from the western side of â€Å"Ma’rib†. During this period, they started building the â€Å"Dam of Ma’rib† which had great importance in the history of Yemen. Sheba was also said to have h ad so great a domain that they had colonies inside and outside Arabia. . From 650 B. C. until 115 B. C. During this era, they gave up the name â€Å"Makrib† and assumed the designation of â€Å"Kings of Sheba†. They also made Ma’rib their capital instead of Sarwah. The ruins of Ma’rib lie at a distance of sixty miles east of San‘a. 3. From 115 B. C. until 300 A. D. During this period, the tribe of Himyar conquered the kingdom of Sheba and took Redan for capital instead of Ma’rib. Later on, Redan was called â€Å"Zifar†. Its ruins still lie on Mudawwar Mountain near the town of â⠂¬Å"Yarim†. During this period, they began to decline and fall.Their trade failed to a very great extent, firstly, because of the Nabetean domain over the north of Hijaz; secondly, because of the Roman superiority over the naval trade routes after the Roman conquest of Egypt, Syria and the north of Hijaz; and thirdly, because of the inter-tribal warfare. Thanks to the three above -mentioned factors, families of Qahtan were disunited and scatteredout. 4. From 300 A. D. until Islam dawned on Yemen. This period witnessed a lot of disorder and turmoil. The great many and civil wars rendered the people of Yemen liable to foreign subjection and hence loss of independence.During this era, the Romans conquered ‘Adn and even helped the Abyssinians (Ethiopians) to occupy Yemen for the first time in 340 A. D. , making use of the constant intra -tribal conflict of Hamdan and Himyar. The Abyssinian (Ethiopian) occupation of Yemen lasted until 378 A. D. , whereafter Yemen regained it s independence. Later on, cracks began to show in Ma’rib Dam which led to the Great Flood (450 or 451 A. D. ) mentioned in the Noble Qur’an. This was a great event which caused the fall of the entire Yemeni civilization and the dispersal of the nations livin g therein. In 523, DhuNawas, a Jew, despatched a great campaign against the Christians of Najran in order to force them to convert into Judaism. Having refused to do so, they were thrown alive into a big ditch where a great fire had been set. The Qur’an referred to this event: †¢ â€Å"Cursed were the people of the ditch. † [85:4] This aroused great wrath among the Christians, and especially the Roman emperors, who not only instigated the Abyssinians (Ethiopians) against Arabs but also assembled a large fleet which helped the Abyssinian (Ethiopian) army, of seventy thousand warriors, to effect a second conquest of Yemen in 525 A. D. under the leadership of Eriat, who was granted rulership over Ye men, a position he held until he was assassinated by one of his army leaders, Abraha, who, after reconciliation with the king of Abyssinia, took rulership over Yemen and, later on, deployed his soldiers to demolish AlKa‘bah, and , hence, he and his soldiers came to be known as the â€Å"Men of the Elephant†. 11 After the â€Å"Elephant† incident, the people of Yemen, under the leadership of Ma‘dikarib bin Saif Dhu Yazin Al-Himyari, and through Persian assistance, revolted against the Abyssinian (Ethiopian) invaders, restored independence and appointed Ma‘dikarib as their king.However, Ma‘dikarib was assassinated by an Abyssinian (Ethiopian) he used to have him around for service and protection. The family of Dhu Yazin was thus deprived of royalty forever. Kisra, the Persian king, appointed a Persian ruler over San‘a and thus made Yeme n a Persian colony. Persian rulers maintained rulership of Yemen until Badhan, the last of them, embraced Islam in 638 A. D. , thus terminating the Persian domain over Yemen. RULERSHIP IN HEERAH: Ever since Korosh the Great (557-529 B. C. ) united the Persians, they ruledIraq and its neighbourhood. Nobody could shake off their authority until Alexander the Great vanquished their king Dara I and thus subdued the Persians in 326 B. C. Persian lands were thenceforth divided and ruled by kings known as â€Å"the Kings of Sects†, an era which lasted until 230 A. D. Meanwhile, the Qahtanians occupied some Iraqi territories, and were later followed by some ‘Adnanians who managed to share some parts of Mesopotamia with them. The Persians, under the leadership of Ardashir, who had established the Sasanian state in 226 A.D, regained enough unity and power to subdue the Arabs living in the vicinity of their kingdom, and force Quda‘a to leave for Syria , leaving the people of Heerah and Anbar under the Persian domain. During the time of Ardashir, Juzaima Alwaddah exercised rulers hip over Heerah, Rabi‘a and Mudar, and Mesopotamia. Ardashir had reckoned that it was impossible for him to rule the Arabs directly and prevent them from attacking his borders unless he appointed as king one of them who enjoyed support and power of his tribe. He had also seen that he could make use of them against the Byzantine kings who always used to harass him.At the same time, the Arabs of Iraq could face the Arabs of Syria who were in the hold of Byzantine kings. However, he deemed it fit to keep a Persian battalion under command of the king of Heerah to be used against those Arabs who might rebel against him. After the death of Juzaima around 268 A. D. , ‘Amr bin ‘Adi bin Nasr Al-Lakhmi was appointed as king by the Persian King Sabour bin Ardashir. ‘Amr was the first of the Lakhmi kings who ruled Heerah until the Persians appointed Qabaz bin Fairuz in whose reign appeared someone called Mazdak, who called for dissoluteness in social life.Qabaz, and many of his subjects, embraced Mazdak’s religion and even called upon the king of Heerah, Al-Munzir bin Ma’ As-Sama’, to follow after. When the latter, because of his pride and self-respect, rejected their orders, Qabaz discharged him and nominated Harith bin ‘Amr bin Hajar Al-Kindi, who had accepted the Mazdaki doctrine. No sooner did Kisra Anu Shairwan succeed Qabaz than he, due to hatred of Mazdak’s philosophy, killed Mazdak and many of his followers, restored Munzir to the throne of Heerah and gave orders to summon under arrest Harith ho sought refuge with Al-Kalb tribe where he spent the rest of his life. Sons of Al-Munzir bin Ma’ As-Sama’ maintained kingship a long time until An-Nu‘man bin Al-Munzir took over. Because of a calumny borne by Zaid bin ‘Adi Al-‘Abbadi, the Persian king got angry with An-Nu‘man and summoned him to his palace. An -Nu‘man went secretly to Hani bin Mas‘ud, chief of Shaiban tribe, and left his wealth and family under the latter’s protection, and then presented himself before the Persian king, who immediately threw him into prison where he perished.Kisra, then, appointed Eyas bin Qubaisa At-Ta’i as king of Heerah. Eyas was ordered to tell Hani bin Mas‘ud to deliver An-Nu‘man’s charge up to Kisra. No sooner than had the Persian king received the fanatically motivated rejection on the part of the Arab chief, he declared war against the tribe of Shaiban and mobilized his troops and warriors under the leadership of King Eyas to a place called Dhee Qar which witnessed a most furious battle wherein the Persians were severely routed by the Arabs for the first time in history.That was very soon after the birth of Prophet Muhammad Oai Caaa Uaia ? Oaa eight months after Eyas bin Qubaisah’s rise to power over Heerah. After Eyas, a Persian ruler was appointed over Heerah, but in 632 A. D. the authority there returned to the family of Lukhm when Al-Munzir Al-Ma‘rur took over. Hardly had the latter’s reign lasted for eight months when Khalid bin Al-Waleed fell upon him with Muslim soldiers. RULERSHIP IN GEOGRAPHICAL SYRIA:I n the process of the tribal emigrations, some septs of Quda‘a reached the borders of Syria where they settled down. They belonged to the family of Sulaih bin Halwan, of whose offspring were the sons of Duj‘am bin Sulaih known as Ad -Duja‘ima. Such septs of Quda‘a were used by the Byzantines in the defence of the Byzantine borders against both Arab Bedouin raiders and the Persians, and enjoyed autonomy for a considerable phase of time which is said to have lasted for the whole second century A. D. One of their most famous kings was Zyiad bin Al-Habula.Their authority however came to an end upon defeat by the Ghassanides who were consequently granted the proxy rulership over the Arabs of Syria and had Dumat Al-Jandal as their headquarters, which last ed until 12 the battle of Yarmuk in the year 13 A. H. Their last king Jabala bin Al-Aihum embraced Islam during the reign of the Chief of Believers, ‘Umar bin Al-Khattab (May Allah be pleased with him). RULERSHIP IN HIJAZ: Ishmael (Peace be upon him) administered authority over Makkah as well as custodianship of the Holy Sanctuary throughout his lifetime.Upon his death, at the age of 137, two of his sons, Nabet and Qidar, succeeded him. Later on, their maternal grandfather, Mudad bin ‘Amr Al-Jurhumi took over, thus transferring rulership over Makkah to the tribe of Jurhum, preserving a venerable position, though very little authority for Ishmael’s sons due to their father’s exploits in building the Holy Sanctuary, a position they held until the decline of the tribe of Jurhum shortly before the rise of Bukhtanassar.The political role of the ‘Adnanides had begun to gain firmer grounds in Makkah, which could be clearly attested by the fact that upon Bukh tanassar’s first invasion of the Arabs in ‘Dhati ‘Irq’, the leader of the Arabs was not from Jurhum. Upon Bukhtanassar’s second invasion in 587 B. C. , however, the ‘Adnanides were frightened out to Yemen, while Burmia An-Nabi fled to Syria with Ma‘ad, but when Bukhtanassar’s pressure lessened, Ma‘ad returned to Makkah to find none of the tribe of Jurhum except Jursham bin Jalhamah, whose daughter, Mu‘ana, was given to Ma‘ad as wife who, later, had a son by him named Nizar.On account of difficult living conditions and destitution prevalent in Makkah, the tribe of Jurhum began to ill-treat visitors of the Holy Sanctuary and extort its funds, which aroused resentment and hatred of the ‘Adnanides (sons of Bakr bin ‘Abd Munaf bin Kinana) who, with the help of the tribe of Khuza‘a that had come to settle in a neighbouring area called Marr Az -Zahran, invaded Jurhum and frightened them out of Makkah le aving rulership to Quda‘a in the middle of the second century A. D. Upon leaving Makkah, Jurhum filled up the well of Zamzam, levelled its place and buried a great many things in it. Amr bin Al-Harith bin Mudad Al-Jurhumi was reported by Ibn Ishaq, the wellknown historian, to have buried the two gold deer together with the Black Stone as well as a lot of jewelry and swords in Zamzam, prior to their sorrowful escape to Yemen. Ishmael’s epoch is estimated to have lasted for twenty centuries B. C. , which means that Jurhum stayed in Makkah for twenty-one centuries and held rulership there for about twenty centuries. Upon defeat of Jurhum, the tribe of Khuza‘a monopolized rulership over Makkah. Mudar tribes, however, enjoyed three privileges: The First: Leading pilgrims from ‘Arafat to Muzdalifah and then from Mina to the ‘Aqabah Stoning Pillar. This was the authority of the family of Al-Ghawth bin Murra, one of the septs of Elias bin Mudar, who were calle d ‘Sofa’. This privilege meant that the pilgrims were not allowed to throw stones at Al-‘Aqabah until one of the ‘Sofa’ men did that. When they had finished stoning and wanted to leave the valley of Mina, ‘Sofa’ men stood on the two sides of Al-‘Aqabah and nobody would pass that position until the men of ‘Sofa’ passed and cleared the way for the pilgrims.When Sofa perished, the family of Sa‘d bin Zaid Manat from Tamim tribe took over. The Second: Al-Ifadah (leaving for Mina after Muzdalifah) on sacrifice morning, and this was the responsibility of the family of Adwan. The Third: Deferment of the sacred months, and this was the responsibility of the family of Tamim bin ‘Adi from Bani Kinana. Khuza‘a’s reign in Makkah lasted for three hundred years, during which, the ‘Adnanides spread all over Najd and the sides of Bahrain and Iraq, while small septs of Quraish remained on the sides of Makka h; they were Haloul, Harum and some families of Kinana.They enjoyed no privileges in Makkah or in the Sacred House until the appearance of Qusai bin Kila b, whose father is said to have died when he was still a baby, and whose mother was subsequently married to Rabi‘a bin Haram, from the tribe of Bani ‘Udhra. Rabi‘a took his wife and her baby to his homeland on the borders of Syria. When Qusai became a young man, he returned to Makkah, which was ruled by Halil bin Habsha from Khuza‘a, who gave Qusai his daughter, Hobba, as wife. After Halil’s death, a war between Khuza‘a and Quraish broke out and resulted in Qusai’s taking hold of Makkah and the Sacred House.THE REASONS OF THIS WAR HAVE BEEN ILLUSTRATED IN THREE VERSIONS: †¢ The First: Having noticed the spread of his offspring, increase of his property and exalt of his honour after Halil’s death, Qusai found himself more entitled to shoulder responsibility of rulership over Ma kkah and custodianship of the Sacred House than the tribes of Khuza‘a and Bani Bakr. He also advocated that Quraish were the chiefs of Ishmael’s descendants. Therefore he consulted some men from Quraish and Kinana concerning his desire to evacuate Khuza‘a and Bani Bakr from Makkah. They took a liking to his opinion and supported him. 13The Second: Khuza‘a claimed that Halil requested Qusai to hold custodianship of Al-Ka‘bah and rulership over Makkah after his death. The Third: Halil g ave the right of Al-Ka‘bah service to his daughter Hobba and appointed Abu Ghabshan Al-Khuza‘i to function as her agent whereof. Upon Halil’s death, Qusai bought this right for a leather bag of wine, which aroused dissatisfaction among the men of Khuza‘a a nd they tried to keep the custodianship of the Sacred House away from Qusai. The latter, however, with the help of Quraish and Kinana, managed to take over and even to expel Khuza‘a comple tely from Makkah.Whatever the truth might have been, the whole affair resulted in the deprivation of Sofa of their privileges, previously mentioned, evacuation of Khuza‘a and Bakr from Makkah and transfer of rulership over Makkah and custodianship of the Holy Sanctuary to Qusai, after fierce wars between Qusai and Khuza‘a inflicting heavy casualties on both sides, reconciliation and then arbitration of Ya‘mur bin ‘Awf, from the tribe of Bakr, whose judgement entailed eligibility of Qusai’s rulership over Makkah and custodianship of the Sacred House, Qusai’s irresponsibility for Khuza‘a’s blood shed, and imposition of blood money on Khuza‘a.Qusai’s reign over Makkah and the Sacred House began in 440 A. D. and allowed him, and Quraish afterwards, absolute rulership over Makkah and undisputed custodianship of the Sacred House to which Arabs from all over Arabia came to pay homage. Qusai brought his kinspeople to Makkah and allocated it to them, allowing Quraish some dwellings there. An-Nus’a, the families of Safwan, Adwan, Murra bin ‘Awf preserved the same rights they used to enjoy before his arrival.A significant achievement credited to Qusai was the establishment of An -Nadwa House (an assembly house) on the northern side of Al-Ka‘bah Mosque, to serve as a meeting place for Quraish. This very house had benefited Quraish a lot because it secured unity of opinions amongst them and cordial solution to their problem. QUSAI HOWEVER ENJOYED THE FOLLONG PRIVILEGED OF LEADERSHIP AND HONOUR: 1 .Presiding over An -Nadwa House meetings where consultations relating to serious issues were conducted, and marriage contracts were announced. 2. The Standard: He monopolized in his hand issues relevant to war launching. 3. Doorkeeping of Al-Ka‘bah: He was the only one eligible to open its gate, and was responsible for its service and protection. 4. Providing water for the Pilgrims: This means that he used to fill basins sweetened by dates and raisins for the pilgrims to drink. . Feeding Pilgrims: This means making food for pilgrims who could not afford it. Qusai even imposed on Quraish annual land tax, paid at the season of pilgrimage, for food. It is noteworthy however that Qusai singled out ‘Abd Manaf, a son of his, for honour and prestige though he was not his elder son (‘Abd Ad -Dar was), and entrusted him with such responsibilities as chairing of An-Nadwa House, the standard, the doorkeeping of Al-Ka‘bah, providing water and food for pilgrims.Due to the fact that Qusai’s deeds were regarded as unquestionable and his orders inviolable, his death gave no rise to conflicts among his sons, but it later did among his grand children, for no sooner than ‘Abd Munaf had died, his sons began to have rows with their cousins — sons of ‘Abd Ad -Dar, which would have given rise to dissension and fighting among the whole tribe of Qurais h, had it not been for a peace treaty whereby posts were reallocated so as to preserve feeding and providing water for pilgrims for the sons of ‘Abd Munaf; while An -Nadwa House, the flag and the doorkeeping of Al-Ka‘bah were maintained for the sons of ‘Abd Ad -Dar. The sons of ‘Abd Munaf, however, cast the lot for their charge, and consequently left the charge of food and water giving toHashim bin ‘Abd Munaf, upon whose death, the charge was taken over by a brother of his called Al-Muttalib bin ‘Abd Manaf and afterwards by ‘Abd Al-Muttalib bin Hashim, the Prophet’s grandfather, whose sons assumed this position until the rise of Islam, during which ‘Abbas bin ‘Abdul-Muttalib was in charge. Many other posts were distriamong people of Quraish for establishing the pillars of a new democratic petite state with government offices and councils similar to those of today. Enlisted as follows are some of these posts. 1. Casting the lots for the idols was allocated to Bani Jumah. 2. Noting of offers and sacrifices, settlement of disputes and relevant is sues were to lie in the hands of Bani Sahm. 3.Consultation was to go to Bani Asad. 4. Organization of blood-money and fines was with Bani Tayim. 14 5. Bearing the national banner was with Bani Omaiyah. 6. The military institute, footmen and cavalry would be Bani Makhzum’s responsibility. 7. Bani ‘Adi would function as foreign mediators. RULERSHIP IN PAN-ARABIA: We have previously mentioned the Qahtanide and ‘Adnanide emigrations, and division of Arabia between these two tribes. Those tribes dwelling near Heerah were subordinate to the Arabian king of Heerah, while those dwelling in the Syrian semi-desert were under domain of the Arabian Ghassanide king, a sort of dependency that was in reality formal rather than actual.However, those living in the hinder deserts enjo yed full autonomy. These tribes in fact had heads chosen by the whole tribe which was a demi-government based on tribal solidarity and collective interests in defence of land and property. Heads of tribes enjoyed dictatorial privileges similar to those of kings, and were rendered full obedience and subordination in both war and peace. Rivalry among cousins for rulership, however, often drove them to outdo one another in entertaining guests, affecting generosity, wisdom and chivalry for the sole purpose of outranking their rivals, and gaining fame among people especially poets who were the official spokesmen at the time.Heads of tribes and masters had special claims to spoils of war such as the quarter of the spoils, whatever he chose for himself, or found on his way back or even the remaining indivisible spoils. THE POLITICAL SITUATION: T he three Arab regions adjacent to foreigners suffered great weakness and inferiority. The people there were either masters or slaves, rulers or subordinates. Masters, especially the foreigners, had claim to every advantage ; slaves had nothing but responsibilities to shoulder. In other words, arbitrary autocratic rulership brought about encroachment on the rights of subordinates, ignorance, oppression, iniquity, injustice and hardship, and turning them into people groping in darkness and ignorance, viz. fertile land which rendered its fruits to the rulers and men of power to extravagantly dissipate on their pleasures and enjoyments, whims and desires, tyranny and aggression. The tribes living near these regions were fluctuating between Syria and Iraq, whereas those living inside Arabia were disunited and governed by tribal conflicts and racial and religious disputes. They had neither a king to sustain their independence nor a supporter to seek advice from, or depend upon, in hardships. The rulers of Hijaz, however, were greatly esteemed and respected by the Arabs, and were considered as rulers and servants of the religious centre. Rulership of Hijaz was, in fact, a mixture of secular and official prec edence as well as religious leadership.They ruled among the Arabs in the name of religious leadership and always monopolized the custodianship of the Holy Sanctuary and its neighbourhood. They looked after the interests of A l-Ka‘bah visitors and were in charge of putting Abraham’s code into effect. They even had such offices and departments like those of the parliaments of today. However, they were too weak to carry the heavy burden, as this evidently came to light during the Abyssinian (Ethiopian) invasion. 15 RELIGIONS OF THE ARABS Most of the Arabs had complied with the call of Ishmael (Peace be upon him) , and professed the religion of his father Abraham (Peace be upon him) They had worshipped Allah, professed His Oneness a nd followed His religion a long time until they forgot part of what they had been reminded of.However, they still maintained such fundamental beliefs such as monotheism as well as various other aspects of Abraham’s religion, until the tim e when a chief of Khuza‘a, namely ‘Amr bin Luhai, who was renowned for righteousness, charity, reverence and care for religion, and was granted unreserved love and obedience by his tribesmen, came back from a trip to Syria where he saw people worship idols, a phenomenon he approved of and believed it to be righteous since Syria was the locus of Messengers and Scriptures, he brought with him an idol (Hubal) which he placed in the middle of Al-Ka‘bah and summoned people to worship it. Readily enough, paganism spread all over Makkah and, thence, to Hijaz, people of Makkah being custodians of not only the Sacred House but the whole Haram as well. A great many idols, bearing different names, were introduced into the area. An idol called ‘Manat’, for instance, was worshipped in a place known as Al-Mushallal near Qadid on the Red Sea. Another, ‘Al-Lat’ in Ta’if, a third, ‘Al-‘Uzza’ in the valley of Nakhlah, and so on and so forth. Polytheism prevailed and the number of idols increased everywhere in Hijaz.It was even mentioned that ‘Amr bin Luhai, with the help of a jinn companion who told him that the idols of Noah’s folk – Wadd, Suwa‘, Yaguth, Ya‘uk and Nasr – were buried in Jeddah, dug them out and took them to Tihama. Upon pilgrimage time, the idols were distributed among the tribes to take back home. Every tribe, and house, had their own idols, and the Sacred House was also overcrowded with them. On the Prophet’s conquest of Makkah, 360 idols were found around Al-Ka‘bah. He broke them down and had them removed and burned up. Polytheism and worship of idols became the most prominent feature of the religion of pre -Islam Arabs despite alleged profession of Abraham’s religion. Traditions and ceremonies of the worship of their idols had been mostly created by ‘Amr bin Luhai, and were deemed as good innovations rather than deviations f rom Abraham’s religion.Some features of their worship of idols were: †¢ †¢ †¢ †¢ Self-devotion to the idols, seeking refuge with them, acclamation of their names, calling for their help in hardship, and supplication to them for fulfillment of wishes, hopefully that the idols (i. e. , heathen gods) would mediate with Allah for the fulfillment of people’s wishes. Performing pilgrimage to the idols, circumrotation round them, self-abasement and even prostrating themselves before them. Seeking favour of idols through various kinds of sacrifices and immolations, which is mentioned in the Qur’anic verses: â€Å"And that which is sacrificed (slaughtered) on An -Nusub (stone-altars)† [5:3] Allah also says: â€Å"Eat not (O believers) of that (meat) on which Allah’s Name has not been pronounced (at the time of the slaughtering of the animal). † [6:121] †¢ Consecration of certain portions of food, drink, cattle, and crops to i dols. Surprisingly enough, portions were also consecrated to Allah Himself, but people often found reasons to transfer parts of Allah’s portion to idols, but never did the opposite. To this effect, the Qur’anic verses go: †¢ â€Å"And they assign to Allah a share of the tilth and cattle which He has created, and they say: ‘This is for Allah according to their pretending, and this is for our (Allah’s so-called) partners. ’ But the share of their (Allah’s so-called) ‘partners’, reaches not Allah, while the share of Allah reaches their (Allah’s so-called) ‘partners’.Evil is the way they judge. † [6:136] 16 †¢ Currying favours with these idols through votive offerings of crops and cattle, to which effect, the Qur’an goes: †¢ â€Å"And according to their pretending, they say that such and such cattle and crops are forbidden, and none should eat of them except those whom we allow. And ( they say) there are cattle forbidden to be used for burden or any other work, and cattle on which (at slaughtering) the Name of Allah is not pronounced; lying against Him (Allah). † [6:138] †¢ Dedication of certain animals (such as Bahira, Sa’iba, Wasila and Hami) to idols, which meant sparing such animals from useful work for the sake of these heathen gods.Bahira, as reported by the well-known historian, Ibn Ish, was daughter of Sa’iba which was a female camel that gave birth to ten successive female animals, but no male ones, was set free and forbidden to yoke, burden or being sheared off its wool, or milked (but for guests to drink from); and so was done to all her female offspring which were given the name ‘Bahira’, after having their ears slit. The Wasila was a female sheep which had ten successive female daughters in five pregnancies. Any new births from this Wasila were assigned only for male people. The Hami was a male camel which produc ed ten progressive females, and was thus similarly forbidden. In mention of this, the Qur’anic verses go: †¢ â€Å"Allah has not instituted things like Bahira ( a she-camel whose milk was spared for the idols and nobody was allowed to milk it) or a Sa’iba (a she camel let loose for free pasture for their false gods, e. g. idols, etc. , and othing was allowed to be c arried on it), or a Wasila (a she-camel set free for idols because it has given birth to a she-camel at its first delivery and then again gives birth to a she-camel at its second delivery) or a Ham (a stallion-camel freed from work for their idols, after it had finished a number of copulations assigned for it, all these animals were liberated in honour of idols as practised by pagan Arabs in the pre Islamic period). But those who disbelieve, invent lies against Allah, and most of them have no understanding. † [5:103] Allah also says: †¢ â€Å"And they say: What is in the bellies of such an d such cattle (milk or foetus) is for our males alone, and forbidden to our females (girls and women), but if it is born dead, then all have shares therein. † [6:139] It has been authentically reported that such superstitions were first invented by ‘Amr bin Luhai.The Arabs believed that such idols, or heathen gods, would bring them nearer to Allah, lead them to Him, and mediate with Him for their sake, to which effect, the Qur’an goes: †¢ â€Å"We worship them only that they may bring us near to Allah. † [39:3], and â€Å"And they worship besides Allah things that hurt them not, nor profit them, and they say: These are our intercessors with Allah. † [10:18] Another divinatory tradition among the Arabs was casting of Azlam (i. e. featherless arrows which were of three kinds: one showing ‘yes’, another ‘no’ and a third was blank) which they used to do in case of serious matters like travel, marriage and the like. If the l ot showed ‘yes’, they would do, if ‘no’, they would delay for the next year.Other kinds of Azlam were cast for water, blood-money or showed ‘from you’, ‘not from you’, or ‘Mulsaq’ (consociated). In cases of doubt in filiation they would resort to the idol of Hubal, with a hundred-came l gift, for the arrow caster. Only the arrows would then decide the sort of relationship. If the arrow showed (from you), then it was decided that the child belonged to the tribe; if it showed (from others), he would then be regarded as an ally, but if (consociated) appeared, the person would retain his position but with no lineage or alliance contract. This was very much like gambling and arrow-shafting whereby they used to divide the meat of the camels they slaughtered according to this tradition.Moreover, they used to have a deep conviction in the tidings of soothsayers, diviners and astrologers. A soothsayer used to traffic in the bus iness of foretelling future events and claim knowledge of private secrets and having jinn subordinates who would communicate the news to him. Some soothsayers claimed that they could uncover the unknown by means of a granted power, while other diviners boasted they could divulge the secrets through a cause-and-effect-inductive process that would lead to detecting a stolen c ommodity, location of a theft, a stray animal, and the like. The astrologer belonged to a third category who used to observe the stars and calculate their movements and orbits whereby he would foretell the future.Lending credence to this news constituted a clue to their conviction that attached special significance to the movements of particular stars with regard to rainfall. The belief in signs as betokening future events, was, of course common among the Arabians. Some days and months and particular animals were regarded as ominous. They also believed that the soul of a murdered person would fly in the wildernes s and would never rest at rest until revenge was 17 taken. Superstition was rampant. Should a deer or bird, when released, turn right then what they embarked on would be regarded auspicious, otherwise they would get pessimistic and withhold from pursuing it.People of pre -Islamic period, whilst believing in superstition, they still retained some of the Abrahamic traditions such as devotion to the Holy Sanctuary, circumambulation, observance of pilgrimage, the vigil on ‘Arafah and offering sacrifices, all of these were observed fully despite some innovations that adulterated these holy rituals. Quraish, for example, out of arrogance, feeling of superiority to other tribes and pride in their custodianship of the Sacred House, would refrain from going to ‘Arafah with the crowd, instead they would stop short at Muzdalifah. The Noble Qur’an rebuked and told them: †¢ â€Å"Then depart from the place whence all the people depart. [2:199] Another heresy, deeply esta blished in their social tradition, dictated that they would not eat dried yoghurt or cooked fat, nor would they enter a tent made of camel hair or seek shade unless in a house of adobe bricks, so long as they were committed to the intention of pilgrimage. They also, out of a deeply-rooted misconception, denied pilgrims, other than Makkans, access to the food they had brought when they wanted to make pilgrimage or lesser pilgrimage. They ordered pilgrims coming from outside Makkah to circumambulate Al-Ka‘bah in Quraish uniform clothes, but if they could not afford them, men were to do so in a state of nudity, and women with only some piece of cloth to hide their groins. Allah says in this concern: †¢ â€Å"O Children of Adam! Take your adornment (by wearing your clean clothes), while praying [and going round (the Tawaf of) the Ka‘bah†. [7:31]If men or women were generous enough to go round Al-Ka‘bah in their clothes, they had to discard them after circum ambulation for good. When the Makkans were in a pilgrimage consecration state, they would not enter their houses through the doors but through holes they used to dig in the back walls. They used to regard such behaviour as deeds of piety and god-fearing. This practice was prohibited by the Qur’an: †¢ â€Å"It is not Al-Birr (piety, righteousness, etc. ) that you enter the houses from the back but Al-Birr (is the quality of the one) who fears Allah. So enter houses through their proper doors, and fear Allah that you may be successful. † [2:189] Such was the religious life in Arabia, polytheism, idolatry, and superstition.Judaism, Christianity, Magianism and Sabianism, however, could find their ways easily into Arabia. The migration of the Jews from Palestine to Arabia passed through two phases: first, as a result of the pressure to which they were exposed, the destruction of the their temple, and taking most of them as captives to Babylon, at the hand of the King B ukhtanassar. In the year B. C. 587 some Jews left Palestine for Hijaz and settled in the northern areas whereof. The second phase started with the Roman occupation of Palestine under the leadership of Roman Buts in 70 A. D. This resulted in a tidal wave of Jewish migration into Hijaz, and Yathrib, Khaibar and Taima’, in particular.Here, they made proselytes of several tribes, built forts and castles, and lived in villages. Judaism managed to play an important role in the pre -Islam political life. When Islam dawned on that land, there had already been several famous Jewish tribes — Khabeer, Al-Musta liq, An-Nadeer, Quraizah and Qainuqa‘. In some versions, the Jewish tribes counted as many as twenty. Judaism was introduced into Yemen by someone called As‘ad Abi Karb. He had gone to fight in Yathrib and there he embraced Judaism and then went back taking with him two rabbis from Bani Quraizah to instruct thpeople of Yemen in this new religion. Judaism found a fertile soil there to propagate and gain adherents.After his death, his son Yusuf Dhu Nawas rose to power, attacked the Christian community in Najran and ordered them to embrace Judaism. When they refused, he ordered that a pit of fire be dug and all the Christians indiscriminately be dropped to burn therein. Estimates say that between 20-40 thousand Christians were killed in that human massacre. The Qur’an related part of that story in Al-Buruj (zodiacal signs) Chapter. Christianity had first made its appearance in Arabia following the entry of the Abyssinian (Ethiopian) and Roman colonists into that country. The Abyssinian (Ethiopian) colonizatio n forces in league with Christian missions entered Yemen as a retaliatory reaction for the iniquities of Dhu Nawas, and started vehemently to propagate their faith ardently.They even built a church and called it Yemeni Al-Ka‘bah with the aim of directing the Arab pilgrimage caravans towards Yemen, and then made an attempt to demolish the Sacred House in Makkah. Allah, the Almighty, however did punish them and made an example of them – here and hereafter. A Christian missionary called Fimion, and known for his ascetic behaviour and working miracles, had likewise infiltrated into Najran. There he called people to Christianity, and by virtue of his honesty and truthful devotion, he managed to persuade them to respond positively to his invitation and embrace Christianity. The principal tribes that embraced Christianity were Ghassan, Taghlib, Tai’ and some Himyarite kings as well as other tribes living on the borders of the Roman Empire. 18Magianism was also popular among the Arabs living in the neighbourhood of Persia, Iraq, Bahrain, Al-Ahsa’ and some areas on the Arabian Gulf coast. Some Yemenis are also reported to have professed Magianism during the Persian occupation. As for Sabianism, excavations in Iraq revealed that it had been popular amongst Kaldanian folks, the Syrians and Ye menis. With the advent of Judaism and Christianity, however, Sabianism began to give way to the new religions, although it retained some followers mixed or adjacent to the Magians in Iraq and the Arabian Gulf. THE RELIGIOUS SITUATION: Such was the religious life of the Arabians before the advent of Islam.The role that the religions prevalent played was so marginal, in fact it was next to nothing. The polytheists, who faked Abrahamism, were so far detached from its precepts, and totally oblivious of its immanent good manners. They plunged into disobedience and ungodliness, and developed certain peculiar religious superstitions that managed to leave a serious impact on the religious and socio -political life in the whole of Arabia. Judaism turned into abominable hypocrisy in league with hegemony. Rabbis turned into lords to the exclusion of the Lord. They got involved in the practice of dictatorial subjection of people and calling their subordinates to account for the least word or id ea.Their sole target turned into acquisition of wealth and power even if it were at the risk of losing their religion, or the emergence of atheism and disbelief. Christianity likewise opened its doors wide to polytheism, and got too difficult to compre hend as a heavenly religion. As a religious practice, it developed a sort of peculiar medley of man and God. It exercised no bearing whatsoever on the souls of the Arabs who professed it simply because it was alien to their style of life and did not have the least relationship with their p